Cloning and Analysis of Chitinase Gene in Bacillus
subtilis HAS
Xiong Guoru1*#,Zhao Gengfeng2#,Cai Wenwei1,Wang Jungang1,Yang Benpeng1,Zhang Shuzhen1*
1.Institute of Tropical Biotechnology/Sugarcane Research Center,CATAS,Haikou571101,China;
2.Department of Biochemistry,Hainan Medical
College,HaiKou571101,China
S ince the early1990s,many scientific researchers at home and abroad
have found that chitinase has a good inhibitory effect on prevention and treatment of various plant pathogens[1-6]. Bacillus subtilis HAS is a good biocontrol strain against Sporisorium scitaminea[7-8]. In order to study the possible mechanism of action,chitinase genes that could in⁃hibit a variety of pathogenic fungi were selected for cloning and analysis.
1Materials and Methods 1.1Materials B.subtilis HAS was isolated and preserved in the laboratory of
sugarcane research center,CATAS;Es鄄cherichia coli DH5αcompetent cells were Zhuangmeng international products.
1.2Methods
1.2.1Primers.According to the whole genome sequence of B.subtilis in Gen⁃Bank(Accession No:Z99117.2),the spe⁃cific primers for chitinase gene of HAS strain were designed:HASF:5’⁃AGGGC AGTTTCTTCATGTATACTGAGTCTG⁃3’; HASR:5’⁃TGAATACTTTTTACTGCAAAT AAAAAGAT⁃3’.
The primers were synthesized by 1.2.2Operation methods.Referred to the
conventional molecular cloning method,
the chitinase gene fragment of HAS strain
was cloned by primers,and the expected
桃园
采集fragment size was1000bp.
1.2.3Sequence processing after sequenc⁃
ing.The sequencing results provided by
Sangon(Shanghai)Biotech Co.,Ltd.were
removed carrier sequence using BioXM2.6
software,and the measured sequence was
aligned using nucleic acid comparison
software on NCBI web site(www.
ncbi.v).The homologous se⁃
quence was found,and similarity analysis
was conducted.
1.2.4Evolutionary analysis of chitinase
gene encoding protein in HAS strain.The
nucleotide sequence of chitinase amplified
from HAS strain were converted into
amino acid sequences,and compared us⁃
ing blastp on NCBI web site(www.
ncbi.v).Using MEGA4.0soft⁃
ware,partial alignment results were used
to construct phylogenetic tree of protein
by Neighbor⁃joining method(NJ).The
phylogenetic tree was evaluated using
Bootstrapping(repeated1000times).
1.2.5Structure analysis and function
prediction of chitinase in HAS strain.The
amino acid sequence and secondary
structure of chitinase gene in HAS were
online⁃predicted using npsa⁃pbil.
ibcp.fr/cgi⁃bin/secpred_mlr.pl.The signal
peptide sequence sites of genes were
online⁃analyzed using SignalP3.0Server
software.
1.2.6Tertiary structure prediction of
chitinase in HAS strain.On the basis of
NBCIblast,the protein sequences of ter⁃
tiary structure homologous to the protein
(Streptomyces N174)were screened,and
then analyzed by ESyPred3D(www.
fundp.ac.be/sciences/biologie/urbm/bioin fo/
esypred/).Through NIH MBI Laboratory
for Structural Genomics and Proteomics
(nihserver.mbi.ucla.edu/SAVS/)web
server,the tertiary structure model con⁃
structed was evaluated using PROCHECK
and ERRAT.
2Results and Analysis
2.1Amplification results of chitinase
gene fragment in HAS strain The
chitinase gene sequences were amplified
from HAS strain by conventional molecu⁃
lar cloning.The sequencing results by
Sangon(Shanghai)Biotech Co.,Ltd.were
removed carrier sequence using BioXM2.6
software,and the fragment was984bp in
length.
2.2Sequence analysis of chitinase
clones Using the nucleic acid comparison
software Blast provided by NCBI web site
(bi.v),the measured
Abstract[Objective]The paper was to study the possible mechanism of chitinase gene.[Method]The chitinase gene with inhibitory effect against
a variety of pathogenic fungi was cloned and analyzed in this study.[Result]The genome of HAS strain contained an ORF of834bp.The homology
of coding protein corresponding to ORF with chitosanase[Bacillus subtilis subsp.subtilis str.168](ref|NP_390566.1)was the highest of98%(272/277).
[Conclusion]Through the analysis of amino acid sequence and secondary structure of the protease,tertiary structure prediction and analysis,HAS strain may play a pivotal role in controlling Sporisorium scitaminea Syd.
Keywords Bacillus subtilis HAS;Sporisorium scitaminea Syd.;Antifungal protein;Chitinase gene
Plant Diseases and Pests2019,10(2):4-6DOI:10.ki.plant-d.p.2019.02.002
Xiong Guoru et al.Cloning and Analysis of Chitinase Gene in Bacillus subtilis HAS
Fig.3Five structural sites in chitinase gene
Fig.1
Phylogenetic tree derived from MEGA4.1based on chitinase gene of HAS strain
sequence was aligned.The chitinase gene sequence cloned from HAS strain had a total length of 984bp,and its homology with Bacillus subtilis complete genome (section 14of 21,from 2613658to 2812830,Z99117.2)was 99%(976/984).According to the analysis of ORF se ⁃quence by BioXM2.6software,the largest ORF was 834bp in length,and the maxi ⁃mum open reading frame was translated into protein sequence,then aligned on NCBI (bi.v).The homology of coding protein corresponding to ORF with chitosanase [Bacillus subtilis subsp.subtilis str.168](ref|NP_390566.1)was the highest of 98%(272/277).There were differences in three amino acids,na
mely amino acids at 47,256,257sites changed (valine replaced glutamic acid,aspartic acid replaced glutamic acid,and lysine replaced asparagine,respectively).Whether these variations change the properties of protein or enhance its bacte ⁃riostasis remains to be further studied.
Meantime,the phylogenetic tree of encoded protein was constructed,and the results were shown in Fig.1.
2.3Analysis of signal peptide,CD,Motif,Prosite of chitinase in HAS strain The signal peptide of chitinase in HAS strain was analyzed using SignalP
3.0Server Online software.The signal peptide of the gene was located at 35and 36amino acids.Therefore,the protein was
secretory type.
Homology search was performed us ⁃ing BLAST in NCBI,and the conservative structure domain (CD)of the sequence was
obtained.The results showed that the chitinase protein in HAS strain had two conservative structure domains of chitosan binding site and catalytic residues (Fig.2).
Fig.2Conserved domains in chitinase protein
Prosite and Motif analysis was per ⁃formed on ProfileScan server.The results showed that there might be five structural sites in the chitinase of HAS strain (Fig.3):
three Casein kinase II phosphorylation sites,amino acids at 51⁃54,205⁃208,235⁃238sites;one N ⁃glycosylation site,amino acids at 55⁃58sites;two N ⁃myris ⁃toylation sites,amino acids at 56⁃61and 165⁃170sites,respectively;three Tyrosine kinase phosphorylation sites,amino acids at 76⁃74,147⁃154,218⁃224sites,respec ⁃tively;two protein kinase C phosphoryla ⁃tion sites,amino acids at 198⁃200,205⁃207sites.Therefore,the protein had more protein kinase phosphorylation sites,indicating the chitinase might require phosphorylation prior before to it func ⁃tions.Meantime,the chitinase encoding gene had a variety of physiological and biochemical functions.
2.4Secondary structure analysis and function prediction of chitinase in HAS strain The cDNA sequence of chitinase in HAS strain was analyzed by DNAStar software.In this sequence,A,T,G and C accounted for 31.65%,2
3.10%,25.15%and 20.10%of the total base number,re ⁃spectively.The content of A+T and G+C were 5
4.75%and 4
5.25%,respectively.This gene was rich in A and T bases.
The physical and chemical properties of chitinase in HAS strain were analyzed and predicted by DNAStar software.Chitinase protein contained 277amino acids,including 44basic amino acids (K,R),39acidic amino acids (D,E),91hy ⁃drophobic amino acids (A,I,L,F,W,V)and 68polar amino acids (N,C,Q,S,T,Y).The molecular weight was 31.44KDa,and the isoelectric point pI was 8.999.
The protein amino acid sequence and secondary structure encoded by chitinase gene in HAS strain were online ⁃predicted using npsa ⁃pbil.ibcp.fr/cgi ⁃bin/npsa_au ⁃tomat.pl?page=/NPSA/npsa_seccons.html.The protein was composed of 277amino acids.In the whole secondary structure,149amino acid residues were α⁃helix,accounting for 53.79%;27amino acid residues were β⁃folded,accounting for 9.75%;97amino acid residues were ran ⁃domly curled,accounting for 35.02%.
2.5Tertiary structure analysis of chitinase gene coding protein From the primary structure,the chitinase of
5
Plant Diseases and Pests2019
HAS strain shared the similarity of36% with the sequence of Streptomyces N174 (Fig.4).However,the3D structures of the two enzymes(Fig.5)were highly similar. From the tertiary structure model of this protein(Fig.6),it could be seen that the chitinase cloned from HAS strain had obvious similarity with the known3D structure of chitinase of Streptomyces N174,and the coincidence degree of the peptide chain was1.66.However,com⁃pared with the known1CHKB,the HAS lacked twoβ⁃folds and oneα⁃helix,but the spatial structure of the active domain was not affected.
Glu at22site and Asp at40site of chitinase of Streptomyces sp.strain N174 were active catalytic sites,and the chiti⁃nase in HAS had no mutation at the catalytic site,so its original activity was maintained.By analyzing the activity of chitinase in Streptomyces sp.strain N174, it could be seen that the activity of the enzyme was mainly to degradeβ⁃1,4⁃gly⁃cosidic bond of chitin,which had strong inhibitory effect on pathogenic fungi and could rapidly degrade the cell wall of pathogenic fungi[9-14].Therefore,the chiti⁃nase obtained from HAS may be one of the main mechanisms for inhibiting S.
scitaminea.
Fig.4Comparison of amino acids sequ⁃ence between HAS and1CHK
Note:a.Three⁃dimensional structure of chit⁃
inase in HAS;b.Three⁃dimensional
structure of chitinase in Streptomyces
N174
Fig.5Comparison of three⁃dimensional
structure of chitinase between HAS
and Streptomyces N174
Note:Red stands for chitinase of HAS;Bule
stands for Streptomyces
N174
Fig.6Alignment map of chitinase bet⁃
ween HAS and Streptomyces sp.
N174
References
[1]INBAR J,CHET I.Biomimics of fungal cell⁃
cell recognition by use of lectin⁃coated nylon
fibers[J].Journal of Bacteriology,1992,174(3):
1055-1059.
[2]PLEBAN S,CHERNIN L,CHET I.Chitinolytic
activity of an endophytic strain of Bacillus
cereus[J].Letters in Applied Microbiology,1997,
25(4):284-288.
[3]PIRKKO H,GLEB A,NAILIA G,et al.Lytic
enzyme complex of an antagonistic Bacillus sp.
X⁃b:isolation and purification of components
[J].Journal of Chromatography B,2001,758(2):
[4]DONALD YK,RALPH MR,JULIE AB,et al.
Characterization of a chitinase gene from
Stenotrophomonas maltophilia strain34S1and
its involvement in biological control[J].Applied
and Environmental Microbiology,2002,68(3):
1047-1054.
[5]YANG WB,FENG B,TONG SM.The antago⁃
nism of chitinase from Strptongces sp.S01
against pathogenic fungi of plant[J].Microbiolo⁃
gy,1997,24(4):224-227.(in Chinese).
[6]ZHAO J,XIONG GR,WANG ZY,et al.Ex⁃
pression of chitosanase gene of Bacillus subtilis
XF⁃1in Escherichia coli and the chitosanase
antagonism against the fungal pathogens[J].
Chinese Journal of Biological Control,2011,
27(4):504-509.(in Chinese).
[7]XIONG GR,ZHAO GF,WU SR,et al.Screen⁃
ing and identification of a biocontrol strain,
HAS antagonistic to Sporisorium scitaminea
Syd[J].Chinese Journal of Tropical Crops,2013,
34(6):1-7.(in Chinese).
[8]XIONG GR,WU SR,ZHANG SZ,et al.Bacil⁃
lus subtilis HAS and its application in con⁃
trolling smut of sugarcane[P].China National
Invention Patent,ZL201210452707.7.(in Chi⁃
nese).
[9]BOUCHER I,DUPUY A,VIDAL P,et al.Pu⁃
rification and characterization of a chitosanase
from Streptomyces N174[J].Applied Microbi⁃
ology and Biotechnology,1992,38(2):188-
193.
[10]MARCOTTE E,HART PJ,BOUCHER I,et al.
Crystallization of a chitosanase from Strepto⁃
异形刷
myces N174[J].Journal of Molecular Biology,
1993,232:995-996.
[11]EDWARD MM,ARTHUR FM,STEPHEN RE,
et al.X⁃ray structure of an anti⁃fungal chi⁃
tosanase from Streptomyces N174[J].Nature
磁带备份
Structural Biology,1996,3(2):155-162. [12]FUKAMIZO T,HONDA Y,GOTO S,et al.
Reaction mechanism of chitosanase from
Streptomyces sp.N174[J].The Biochemical
Journal,1995,311(part2):?377-383.
[13]HONDA Y,FUKAMIZO T,OKAJIMA T,et al.
Thermal unfolding of chitosanase from Strep⁃
tomyces sp.N174:role of tryptophan residues
in the protein structure stabilization[J].Bioch⁃
imica et Biophysica Acta,1999,1429(2):
宠物包
[14]LACOMBE⁃HARVEY ME,FUKAMIZO T,
GAGNON J,et al.Accessory active site residues
of Streptomyces sp.N174chitosanase[J].The
FEBS Journal,2009,276(3):857-869.
6
